GAAAACCCGCUCUGAUCAGAGUAACGCAGUAAGCGU
Initializing EVA...
Initializing EVA...
Loading RNA Designer...
Circular RNA engineering for stable expression, vaccine platforms & sponge design.
Distributional comparisons between AI generated RNAs and natural RNAs.

Red indicates EVA-generated RNA; blue or green backgrounds indicate natural RNA distributions.
Distributional comparisons between AI generated RNAs and natural RNAs.

Red indicates EVA-generated RNA; blue or green backgrounds indicate natural RNA distributions.