UAUGAGCUGCCCCAUAGUACCUGUAAAUCCAUUCGU
Initializing EVA...
Initializing EVA...
Loading RNA Designer...
Messenger RNA optimization for vaccines, therapeutics & protein expression engineering.
Distributional comparisons between AI generated RNAs and natural RNAs.

Red indicates EVA-generated RNA; blue or green backgrounds indicate natural RNA distributions.
Distributional comparisons between AI generated RNAs and natural RNAs.

Red indicates EVA-generated RNA; blue or green backgrounds indicate natural RNA distributions.